Home Current issue Instructions
About us Archives Login 
Editorial board Search articles Contact us
Home Print this page Email this page Users Online: 1513

 Table of Contents  
ORIGINAL ARTICLE
Year : 2017  |  Volume : 6  |  Issue : 1  |  Page : 29-35

Effectiveness of nonsurgical periodontal therapy on the levels of Helicobacter pylori in dental plaque and saliva of patients with chronic periodontitis


Department of Periodontology, Krishnadevaraya College of Dental Sciences and Hospital, Hunasamaranahalli, Bengaluru, Karnataka, India

Date of Web Publication18-Jan-2017

Correspondence Address:
Rudrakshi Chickanna
Department of Periodontology, Krishnadevaraya College of Dental Sciences and Hospital, Hunasamaranahalli, Bengaluru - 562 157, Karnataka
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/2278-9626.198604

Rights and Permissions
  Abstract 

Objectives: Presence of Helicobacter pylori in the oral cavity may enhance the risk for gastric re-infection; hence, the present study was carried out to detect and compare the levels of H. pylori in subgingival plaque and saliva of patients with periodontal health and chronic periodontitis at baseline and 3 months following scaling and root planing (SRP). Methods: A total of 45 patients with 30 patients having chronic periodontitis (test group) and 15 periodontally healthy patients (control group) were considered. H. pylori was detected in subgingival plaque and saliva samples, collected at baseline and at 3 months using polymerase chain reaction. Clinical parameters were recorded at baseline, 1 month, 2 months, and 3 months. Results: At the baseline, in test group 60% and 40% of the samples were positive for H. pylori and in control group 26.7% and 13.3% of the samples were positive for H. pylori in subgingival plaque and saliva, respectively. At 3 months, 26.7% and 20% samples were positive for H. pylori in the test group and in control group 13.3% and 6.7% samples were positive for H. pylori in subgingival plaque and saliva, respectively, demonstrating higher levels of H. pylori in dental plaque than in saliva. There was a significant reduction in the percentage of H. pylori in subgingival plaque following SRP. Conclusion: Periodontal treatment has shown to be effective in reducing the levels of H. pylori from the oral cavity.

Keywords: Chronic periodontitis, dental plaque, scaling and root planing


How to cite this article:
Venkata T, Chickanna R, Prabhuji M. Effectiveness of nonsurgical periodontal therapy on the levels of Helicobacter pylori in dental plaque and saliva of patients with chronic periodontitis. Eur J Gen Dent 2017;6:29-35

How to cite this URL:
Venkata T, Chickanna R, Prabhuji M. Effectiveness of nonsurgical periodontal therapy on the levels of Helicobacter pylori in dental plaque and saliva of patients with chronic periodontitis. Eur J Gen Dent [serial online] 2017 [cited 2019 Oct 16];6:29-35. Available from: http://www.ejgd.org/text.asp?2017/6/1/29/198604


  Introduction Top


An oral cavity is a permanent reservoir of several bacterial pathogens of medical importance. [1] Helicobacter pylori is a Gram-negative, spiral-shaped, microaerophilic, flagellated bacterium implicated in the etiology of numerous gastrointestinal diseases such as peptic, duodenal ulcers, gastric carcinoma, and mucosa-associated lymphoid tissue lymphoma. [2],[3],[4] There is evidence that the primary extragastric reservoir of H. pylori is an oral cavity. [5],[6],[7]

H. pylori infection appears to involve in the oral route as an important mode of transmission. H. pylori detected in the oral cavity has been observed in saliva, [8],[9],[10],[11] supragingival plaque, [12],[13],[14],[15],[16] subgingival dental plaque, [12],[16],[17],[18],[19],[20],[21],[22] microbiota of the dorsum of the tongue, [23] on the surface of oral ulcerations, [24] and on the surface of oral neoplasias. [25] An association between the presence of H. pylori in dental plaque and gastritis has been demonstrated. Higher prevalence of H. pylori has been observed in dental plaque than in stomach in patients with chronic gastritis. [26]

Although H. pylori has been detected in different sites, periodontal pocket can be regarded as a natural reservoir for H. pylori as it provides microaerophilic conditions suitable for its growth. [27] Poor oral health and periodontitis have shown to be associated with high prevalence of gastritis caused by H. pylori. [28],[29],[30] Oral hygiene parameters such as the presence of plaque and gingival bleeding have positively correlated with H. pylori in the oral cavity. [15],[31]

Oral H. pylori is seldom eliminated by systemic eradication therapy, [7] therefore the importance of oral hygiene and periodontal procedures such as scaling and root planing (SRP) needs to be emphasized as an adjunct to eliminate H. pylori from the oral cavity. [32] There is a need to elucidate whether the oral cavity is a permanent or transient reservoir of H. pylori and the effect of nonsurgical periodontal therapy in eliminating H. pylori from the oral cavity. Hence, the aim of the present study was to evaluate the effect of plaque control and SRP in terms of eliminating H. pylori from oral cavity in dental plaque and saliva of patients with periodontal health and chronic periodontitis.


  Materials And Methods Top


Forty-five patients (23 males and 22 females) in the age group of 18-60 years (with a mean of 39 years) were selected. Patients for the study were recruited from the outpatient section, Department of Periodontology, Krishnadevaraya College of Dental Sciences and Hospital, affiliated to the Rajiv Gandhi University of Health Sciences, Bengaluru, and ethical guidelines outlined in the Helsinki Declaration of 1975 as revised in 2000 were followed. All the eligible cases, who volunteered, were informed about the nature, potential risks, and benefits of their participation in the study and written informed consent was obtained from all the cases. The study protocol was approved by the Institutional Ethical Committee (approval KCDS/302/PG/2011-12).

Selection criteria

The inclusion criteria of cases were as follows:

  • Systemically healthy patients
  • Fifteen patients having clinically healthy gingiva with probing depth (PD) <3 mm and ≤10% sites with bleeding on probing as Group I
  • Thirty chronic periodontitis patients having PD more than or equal to 5 mm at more than 30% of sites with relative attachment level (RAL) more than or equal to 3 mm and more than 10% sites with bleeding on probing positive as Group II.


Exclusion criteria were as follows:

  • Chronic gastritis patients were excluded in the present study based on rapid urease test (RUT)
  • Patients who were under medications such as antibiotics, prolonged use of anti-inflammatory drugs, or the use of antacids in past 6 months
  • Patients who had undergone professional tooth cleaning or any other periodontal treatment within the past 6 months
  • Patients with less than twenty teeth
  • Smokers
  • Aggressive periodontitis patients.


Clinical examination

Full-mouth periodontal examination was carried out in all cases. Patients were divided into two groups as described in inclusion criteria. The clinical parameters assessed were plaque index (PI), [33] modified sulcular bleeding index (mSBI), [34] probing pocket depth, [35] and RAL. [36] Clinical parameters were recorded at baseline, 1 st , 2 nd , and 3 rd month follow-up visits.

Sample collection

Before collecting the subgingival plaque, tooth was dried and isolated with cotton rolls. Supragingival plaque was removed from the sampling site by hand scaling. In the test group, plaque samples were collected from the deepest periodontal pocket in each quadrant and pooled. [37] In the control group, samples were collected from randomly selected sites. Subgingival plaque was collected by an upward scrape against the tooth surface with a sterile periodontal curette. [37] The unstimulated whole saliva was allowed to pool in the floor of the mouth and subsequently aspirated using 5 ml disposable syringe. [38] Dental plaque and saliva samples were collected at baseline and at the end of 3 rd month follow-up from both the groups. The collected samples were stored at − 20°C temperature and transferred to TE buffer solution (Tris-HCl 10 mm and ethylenediaminetetraacetic acid (EDTA) 1 mm, pH 7.6) to the laboratory for polymerase chain reaction (PCR) analysis.

Periodontal treatment

All the cases received SRP and oral hygiene instructions. SRP was performed in two to four appointments of approximately 60 min each under local anesthesia (2% lignocaine hydrochloride with 1:200,000 adrenaline) using area-specific periodontal curettes and an ultrasonic device. The treatment was concluded without the use of systemic antibiotics or local antimicrobials. After baseline recording of clinical parameters, collection of dental plaque and saliva samples were done. All the patients were instructed to perform plaque control using toothbrush, dental floss, and interdental toothbrushes as necessary. Samples were again collected at the end of 3 months following SRP.

Microbiological analysis

Detection frequency of H. pylori was analyzed by means of "hot start PCR," which is a variation in conventional PCR. Subgingival plaque and saliva samples suspended in phosphate buffered saline were washed thrice in TE buffer (Tris-HCl 10 mm and EDTA 1 mm, pH 7.6) and once in lysis buffer I and II and then incubated with 100 μg/ml of proteinase K for 2 h at 65°C. Following this, samples were boiled for 10 min at 90°C, and supernatant is stored at −20°C till processed. Primers used were JW21, the upstream primer (5' GCGACCTGCTGGAACATTAC 3' nucleotides 691-710) and JW22, the downstream primer (5' CGTTAGCTGCATTACTGGAGA 3', nucleotides 829-809). The reagents were added to the sample in laminar airflow. DNA polymerase enzyme was added in the last and mixed by pipetting up and down. DNA amplification was carried out in a thermocycler that heats and cools the reaction tubes within it to the precise temperature required for each step of the reaction. Taq polymerase has allowed the automatization of the reaction using specific appliances such as thermocycler. The final PCR amplification product obtained was subjected to gel electrophoresis and further analyzed under ultraviolet transilluminator. Finally, PCR amplification products were compared with standard molecular markers. The result obtained was subjected to statistical analysis.

Statistical analysis

Analysis of variance test was applied to determine the intergroup differences in clinical parameters between the test and control groups. Pearson's Chi-square test was applied to compare the percentage of samples positive for H. pylori between the control and test group at baseline and 3 months. Spearman's correlation coefficient (r value) was used to determine the association between PD and percentage of H. pylori detected. If r value is positive, it indicates that the association is present and if r value is negative, it indicates that the association is not present. The P = 0.05 or less was considered to be statistically significant. The data were analyzed using the SPSS Inc. Statistical Package for the Social Sciences (SPSS) is a software package used in statistical analysis of data. It was developed by SPSS Inc.


  Results Top


Clinical results

[Table 1] shows the descriptive statistics of clinical parameters including PI, mSBI, and PD of both the groups. There was a reduction in all the clinical parameters from baseline to 3-month follow-up. Although the scores of PI and mSBI improved over time, between group analyses revealed no significant differences (PI: P = 0.086, mSBI: P = 0.090). Statistically, significant differences were observed in the PD and RAL [Table 1a] when the comparison was made between the control and test groups (PD: P = 0.031, RAL: P = 0.025) [Graph 1].
Table 1: Descriptive statistics of clinical parameters in control and test groups


Click here to view
Table 1a: Comparison of relative attachment level within Group II


Click here to view




Microbial results

[Table 2] represents the intergroup comparison of the percentage of H. pylori between control and test group. In the control group, at baseline 26.7% subgingival plaque samples and 13.3% saliva samples were found to be positive for H. pylori. At 3 month follow-up, the percentage of detection of H. pylori reduced to 13.3% and 6.7%, respectively, in subgingival plaque and saliva. In the test group, at baseline 60% subgingival plaque samples and 40% saliva samples were found to be positive for H. pylori. At 3 month follow-up, the percentage of detection of H. pylori reduced to 26.7% and 20%, respectively, in subgingival plaque and saliva. There was a significant difference in the reduction in the percentage of H. pylori in subgingival plaque when compared from baseline to 3 months (P = 0.031). However, in saliva, the reduction is not statistically significant (P = 0.245) [Graphs 2 and 3].
Table 2: Intergroup comparison of the percentage of Helicobacter pylori


Click here to view






Spearman's correlation coefficient was applied to determine the association between PD and percentage of H. pylori. The correlation coefficient was positive indicating a positive correlation between the PD and percentage of H. pylori [Table 3].
Table 3: Spearman's correlation coefficient to determine the association between probing depth and percentage of Helicobacter pylori detection

Click here to view



  Discussion Top


Dental plaque consists of a variety of microorganisms which are responsible for initiation and progression of periodontal diseases. It has been shown that there is a significant increase in the number of these microorganisms once the gingival sulcus is converted into the periodontal pocket. [39] Periodontal pockets can serve as an ideal habitat for microaerophilic and anaerobic microorganisms due to its favorable architecture and microcosm. [22] Dental plaque and periodontal pockets can act as reservoirs of H. pylori since it is a microaerophilic organism. Recent studies [7],[32] have reported that the presence of H. pylori in dental plaque can cause recurrence of gastric H. pylori following its eradication, thereby stressing the significance of plaque control. Since the literature is lacking in the arena of the efficacy of periodontal treatment to prevent gastric re-infection, the present study emphasizes the need for periodontal treatment to eliminate or reduce the oral H. pylori levels.

Helicobacter pylori in dental plaque

Numerous studies in literature have shown oral cavity as a reservoir of H. pylori. According to some studies, [40],[41] H. pylori has only a transient presence in the oral cavity and if present may be the result of occasional gastroesophageal reflux. On the other hand, some authors viewed H. pylori as a permanent resident in the oral cavity. These variations are attributed to the differences in the techniques used to detect H. pylori. Studies carried out on Indian population have shown a high prevalence of H. pylori in the oral cavity. [22],[28] A recent study on the same population by Agarwal and Jithendra [22] demonstrated H. pylori in 60% of subgingival plaque samples in chronic periodontitis patients whose gastric biopsies were H. pylori positive, whereas control group (chronic periodontitis, who never had gastritis) demonstrated 15% samples positive for H. pylori. Similar results were reported by Anand et al. in 2006. [28]

Distinguishingly, decreasing pattern of distribution of H. pylori has been observed in the supragingival plaque on molars, showing their high prevalence when compared to the anterior teeth. [42] Reasons for this high prevalence in posterior teeth are less access for oral hygiene and also posterior teeth provide a more microaerophilic environment for the survival of H. pylori. Dental biofilms provide urea and further facilitate the growth of urease producing bacteria such as H. pylori. [5] In correlation to these findings, the present study showed a higher prevalence of H. pylori in subgingival plaque from chronic periodontitis patients. Similarly, Al Asqah et al. [20] demonstrated H. pylori in 78% of subgingival plaque samples obtained from the periodontitis patients.

Anderson et al. [43] justifies that dental plaque act as a reservoir for H. pylori by demonstrating the ability of H. pylori to coaggregate with Fusobacterium nucleatum and Fusobacterium periodonticum, which are early and late colonizers of the oral cavity, respectively. The present study also demonstrates the increase in the percentage of H. pylori in dental plaque of chronic periodontitis patients. [43] On contrary, it has been reported that early colonizers such as Streptococcus and Actinomyces species produce bacteriocin-like inhibitory proteins against H. pylori. This inhibitory activity on H. pylori[44] explains the low prevalence of H. pylori in periodontally healthy patients.

In the current study, our objective was to determine whether the oral cavity could act as a reservoir for H. pylori regardless of gastric infection. In contrast to most of the studies, [6],[12],[18],[22],[28],[29] we evaluated cases who reported no history of gastric symptoms. The findings of our study are similar to Souto and Colombo [19] who observed a higher prevalence of H. pylori in subgingival biofilm samples (33.3%) compared to saliva samples (20%) in nondyspeptic patients. Berroteran et al. [45] detected H. pylori in the dental plaque of 15% of nondyspeptic patients which is low when compared with our study, whereas Martinez-Gomis et al. [46] did not detect this bacterium in any of the ten selected cases without dyspepsia, which is in contrast to the present study.

Olivier et al. [47] failed to detect H. pylori in dental plaque from cases without periodontitis who had positive stomach biopsies. Umeda et al. [29] reported that eradication of H. pylori from the stomach did not eliminate it from the oral cavity. This shows that periodontal pockets can act as a reservoir of H. pylori even after its eradication from the stomach. Gebara et al. [7] showed that 60% of cases with periodontal disease were still positive for H. pylori in their oral cavity, whereas only 10% were positive in the stomach after triple therapy (triple therapy is a combination of omeprazole 20 mg, amoxicillin 1 g, and clarithromycin 500 mg twice daily for 7 days). These findings suggest that the frequency of H. pylori in the oral cavity is related more to the presence of periodontal disease than to the existence of gastric infection. In a recent meta-analysis, Zou and Li [48] demonstrated that the prevalence of H. pylori infection in oral cavity was significantly increased in gastric H. pylori-positive patients compared with gastric H. pylori-negative patients with an odds ratio (OR) of 3.61 (range: 1.91-6.82). OR differs with different diagnostic methods [49] with PCR showing the highest (5.11) and RUT showing the lowest (2.00). This study also showed that the eradication efficiency of H. pylori in the stomach is significantly higher (85.8%) compared with that in the oral cavity (5.7%) when triple therapy is used. H. pylori in the oral cavity are more difficult to be eradicated than in the stomach.

Helicobacter pylori in saliva

H. pylori are commonly transmitted person-to-person by saliva. Saliva is therefore considered as an important vehicle for H. pylori. Li et al. (1995, 1996) [8],[49] reported a high prevalence of H. pylori (75%, 84%) in saliva specimens in patients with proven gastric H. pylori infection. Similarly, Song et al. [42] demonstrated a high prevalence of H. pylori (100%) in saliva specimens. These studies reported a higher prevalence rate compared to the present study. In contrary, Ferguson et al. [50] were able to isolate H. pylori from only one saliva specimen out of the nine samples examined. Bürgers et al. [51] showed that H. pylori can occur in the oral cavity independent of gastric colonization. Several other studies [14],[16],[17],[52],[53] failed to detect H. pylori in the saliva and subgingival plaque or found no association between periodontal status and the prevalence of the bacteria in the oral cavity.

Antimicrobial therapy fails to resolve H. pylori infection from the oral cavity as anti-H. pylori doses are difficult to achieve in saliva. [29] H. pylori recolonized in gastric mucosa from dental plaque has been found to be inaccessible to systemic antimicrobial therapy. [7],[29] Dental plaque can be efficiently removed by professional and daily oral hygiene thus controlling H. pylori infection in the oral cavity. [32]

Effect of plaque control on Helicobacter pylori

SRP was performed in the present study to examine its effect on H. pylori levels. Following, there was a significant reduction in H. pylori levels. This finding is similar to a recent case series by Escobar [54] where full-mouth ultrasonic debridement has shown to reduce the percentage of H. pylori but not eradicated from all the samples. This result shows that the efficacy of nonsurgical treatment modalities may reduce only the depth of periodontal pockets but cannot treat the deep pockets (>5 mm) completely. Hence, other treatment modalities such as open flap debridement have been advocated.

Results from studies by Zaric et al. [55] and Jia et al. [5] showed that percentage of H. pylori eradication is greater in patients who received combined periodontal and triple therapy when compared to triple therapy alone. A recent meta-analysis concluded that adjunctive use of periodontal treatment to systemic eradication therapy can reduce gastric H. pylori recurrence compared with systemic eradication therapy alone. [32] A combination of periodontal treatment with systemic therapy holds a promising approach for eradicating H. pylori and thereby decreasing the risk of re-infection. [32],[55] Marbaix et al. [56] reported an update of scientific data showing the potential localization of H. pylori in the oral cavity of periodontitis patients and also proposed a multidisciplinary clinical protocol combining full-mouth disinfection and triple therapy to enhance eradication of oral H. pylori.

Multidisciplinary clinical protocol for the eradication of oral H. pylori[56] as proposed by Marbaix et al.

Oral hygiene instructions: Tooth brushing, interdental plaque removal, tongue scraping

Full-mouth disinfection (one or two sessions performed within 24 h): Mechanical scaling/root planning (or ultrasonic debridement), subgingival chlorhexidine irrigation, and tongue disinfection with chlorhexidine gel

Triple therapy along with chlorhexidine mouthwash for 2 weeks should be started immediately following the last session of full-mouth disinfection.

H. pylori are found in low numbers in the normal oral flora, where their reliable detection is difficult. [13] It has been speculated that dental plaque might harbor H. pylori and act as a permanent reservoir thereby causing gastric re-infection. H. pylori[40],[41] constantly present in dental plaque may be the result of occasional gastroesophageal reflux.

Bernander et al. [57] and Krajden et al. [58] reported that detection frequency of H. pylori in the oral cavity was lower than that in the stomach when culture method was used. This might be due to the lack of culture growth because of an insufficient number of cells or presence of unculturable but viable coccoid forms. [59] These limitations of culture method have been overcome by the use of PCR.

In the present study, at 3 months follow-up, there was 20% and 26.7% samples were positive for H. pylori in saliva and subgingival plaque, respectively, in the test group and 6.7% and 13.3% samples were positive for H. pylori in the control group. The percentage detected was reduced significantly following SRP. However, some of the limitations of the present study are: First, the sample size of the study was less. Second, repeated sampling of the same site was not done. The actual number of viable H. pylori was not detected since PCR permits the detection of nonviable H. pylori, which can be noninfectious. It allows the detection of even low numbers of bacteria, which may be too few to influence gastric health.


  Conclusion Top


Within the limitations of the present study, dental plaque control is an effective way to reduce the load of H. pylori from the oral cavity. Therefore, professional plaque control along with standard daily plaque removal procedures should be recommended to patients with chronic gastritis or peptic ulcer prior to the triple therapy. However, further studies using larger sample size and sensitive and specific methods for detection of H. pylori are required to better assess the relationship of dental plaque, oral hygiene status, and periodontal disease with H. pylori infection. Once these relationships are better understood, intervention strategies can be designed to better endeavor the burden of H. pylori infection in the oral cavity.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

 
  References Top

1.
Souto R, de Andrade AF, Uzeda M, Colombo AP. Prevalence of ''non-oral'' pathogenic bacteria in subgingival biofilm of subjects with chronic periodontitis. Braz J Microbiol 2006;37:208-15.  Back to cited text no. 1
    
2.
Dixon MF. Helicobacter pylori and peptic ulceration: Histopathological aspects. J Gastroenterol Hepatol 1991;6:125-30.  Back to cited text no. 2
    
3.
Wotherspoon AC, Ortiz-Hidalgo C, Falzon MR, Isaacson PG. Helicobacter pylori-associated gastritis and primary B-cell gastric lymphoma. Lancet 1991;338:1175-6.  Back to cited text no. 3
    
4.
Tytgat GN, Noach LA, Rauws EA. Helicobacter pylori infection and duodenal ulcer disease. Gastroenterol Clin North Am 1993;22:127-39.  Back to cited text no. 4
    
5.
Jia CL, Jiang GS, Li CH, Li CR. Effect of dental plaque control on infection of Helicobacter pylori in gastric mucosa. J Periodontol 2009;80:1606-9.  Back to cited text no. 5
    
6.
Mapstone NP, Lynch DA, Lewis FA, Axon AT, Tompkins DS, Dixon MF, et al. Identification of Helicobacter pylori DNA in the mouths and stomachs of patients with gastritis using PCR. J Clin Pathol 1993;46:540-3.  Back to cited text no. 6
    
7.
Gebara EC, Faria CM, Pannuti C, Chehter L, Mayer MP, Lima LA. Persistence of Helicobacter pylori in the oral cavity after systemic eradication therapy. J Clin Periodontol 2006;33:329-33.  Back to cited text no. 7
    
8.
Li C, Musich PR, Ha T, Ferguson DA Jr., Patel NR, Chi DS, et al. High prevalence of Helicobacter pylori in saliva demonstrated by a novel PCR assay. J Clin Pathol 1995;48:662-6.  Back to cited text no. 8
    
9.
Gebara EC, Pannuti C, Faria CM, Chehter L, Mayer MP, Lima LA. Prevalence of Helicobacter pylori detected by polymerase chain reaction in the oral cavity of periodontitis patients. Oral Microbiol Immunol 2004;19:277-80.  Back to cited text no. 9
    
10.
Suzuki N, Yoneda M, Naito T, Iwamoto T, Masuo Y, Yamada K, et al. Detection of Helicobacter pylori DNA in the saliva of patients complaining of halitosis. J Med Microbiol 2008;57(Pt 12):1553-9.  Back to cited text no. 10
    
11.
Saxena RK, Aziz AS, Kalekar MG, MilseeMol JP, Suryakar AN, Tabita B, et al. Presence of Helicobacter pylori detected by PCR in saliva of male smokers and non-smokers with chronic periodontitis. Br J Med Med Res 2013;3:329-40.  Back to cited text no. 11
    
12.
Nguyen AM, Engstrand L, Genta RM, Graham DY, el-Zaatari FA. Detection of Helicobacter pylori in dental plaque by reverse transcription-polymerase chain reaction. J Clin Microbiol 1993;31:783-7.  Back to cited text no. 12
    
13.
Song Q, Haller B, Ulrich D, Wichelhaus A, Adler G, Bode G. Quantitation of Helicobacter pylori in dental plaque samples by competitive polymerase chain reaction. J Clin Pathol 2000;53:218-22.  Back to cited text no. 13
    
14.
Kignel S, de Almeida Pina F, André EA, Alves Mayer MP, Birman EG. Occurrence of Helicobacter pylori in dental plaque and saliva of dyspeptic patients. Oral Dis 2005;11:17-21.  Back to cited text no. 14
    
15.
Silva DG, Stevens RH, Macedo JM, Albano RM, Falabella ME, Fischer RG, et al. Presence of Helicobacter pylori in supragingival dental plaque of individuals with periodontal disease and upper gastric diseases. Arch Oral Biol 2010;55:896-901.  Back to cited text no. 15
    
16.
Eskandari A, Mahmoudpour A, Abolfazli N, Lafzi A. Detection of Helicobacter pylori using PCR in dental plaque of patients with and without gastritis. Med Oral Patol Oral Cir Bucal 2010;15:e28-31.  Back to cited text no. 16
    
17.
Asikainen S, Chen C, Slots J. Absence of Helicobacter pylori in subgingival samples determined by polymerase chain reaction. Oral Microbiol Immunol 1994;9:318-20.  Back to cited text no. 17
    
18.
Riggio MP, Lennon A. Identification by PCR of Helicobacter pylori in subgingival plaque of adult periodontitis patients. J Med Microbiol 1999;48:317-22.  Back to cited text no. 18
    
19.
Souto R, Colombo AP. Detection of Helicobacter pylori by polymerase chain reaction in the subgingival biofilm and saliva of non-dyspeptic periodontal patients. J Periodontol 2008;79:97-103.  Back to cited text no. 19
    
20.
Al Asqah M, Al Hamoudi N, Anil S, Al Jebreen A, Al-Hamoudi WK. Is the presence of Helicobacter pylori in dental plaque of patients with chronic periodontitis a risk factor for gastric infection? Can J Gastroenterol 2009;23:177-9.  Back to cited text no. 20
    
21.
Diouf A, Seck-Diallo AM, Faye M, Benoist HM, Sembene M, Diallo PD, et al. Prevalence of Helicobacter pylori detected by real-time PCR in the subgingival plaque of patients with chronic periodontitis. Odontostomatol Trop 2011;34:5-12.  Back to cited text no. 21
    
22.
Agarwal S, Jithendra KD. Presence of Helicobacter pylori in subgingival plaque of periodontitis patients with and without dyspepsia, detected by polymerase chain reaction and culture. J Indian Soc Periodontol 2012;16:398-403.  Back to cited text no. 22
[PUBMED]  Medknow Journal  
23.
Ozdemir A, Mas MR, Sahin S, Saglamkaya U, Ateskan U. Detection of Helicobacter pylori colonization in dental plaques and tongue scrapings of patients with chronic gastritis. Quintessence Int 2001;32:131-4.  Back to cited text no. 23
    
24.
Birek C, Grandhi R, McNeill K, Singer D, Ficarra G, Bowden G. Detection of Helicobacter pylori in oral aphthous ulcers. J Oral Pathol Med 1999;28:197-203.  Back to cited text no. 24
    
25.
Okuda K, Ishihara K, Miura T, Katakura A, Noma H, Ebihara Y. Helicobacter pylori may have only a transient presence in the oral cavity and on the surface of oral cancer. Microbiol Immunol 2000;44:385-8.  Back to cited text no. 25
    
26.
Siddiq M, Haseeb-ur-Rehman A, Mahmood A. Evidence of Helicobacter pylori infection in dental plaque and gastric mucosa. J Coll Physicians Surg Pak 2004;14:205-7.  Back to cited text no. 26
    
27.
Schein W, Meryn S. Helicobacter pylori and the mouth cavity - Overview and perspectives. Wien Klin Wochenschr 1994;106:547-9.  Back to cited text no. 27
    
28.
Anand PS, Nandakumar K, Shenoy KT. Are dental plaque, poor oral hygiene, and periodontal disease associated with Helicobacter pylori infection? J Periodontol 2006;77:692-8.  Back to cited text no. 28
    
29.
Umeda M, Kobayashi H, Takeuchi Y, Hayashi J, Morotome-Hayashi Y, Yano K, et al. High prevalence of Helicobacter pylori detected by PCR in the oral cavities of periodontitis patients. J Periodontol 2003;74:129-34.  Back to cited text no. 29
    
30.
Namiot DB, Namiot Z, Kemona A, Golebiewska M. Peptic ulcers and oral health status. Adv Med Sci 2006;51:153-5.  Back to cited text no. 30
    
31.
Namiot DB, Namiot Z, Kemona A, Bucki R, Gotebiewska M. Oral health status and oral hygiene practices of patients with peptic ulcer and how these affect Helicobacter pylori eradication from the stomach. Helicobacter 2007;12:63-7.  Back to cited text no. 31
    
32.
Bouziane A, Ahid S, Abouqal R, Ennibi O. Effect of periodontal therapy on prevention of gastric Helicobacter pylori recurrence: A systematic review and meta-analysis. J Clin Periodontol 2012;39:1166-73.  Back to cited text no. 32
    
33.
Löe H. The gingival index, the plaque index and the retention index systems. J Periodontol 1967;38:610-6.  Back to cited text no. 33
    
34.
Mombelli A, van Oosten MA, Schurch E Jr., Land NP. The microbiota associated with successful or failing osseointegrated titanium implants. Oral Microbiol Immunol 1987;2:145-51.  Back to cited text no. 34
    
35.
Eickholz P. Clinical periodontal diagnosis: Probing pocket depth, vertical attachment level and bleeding on probing. Perio Quintessenz 2004;1:75-80.  Back to cited text no. 35
    
36.
Vandana KL, Gupta I. The location of cemento enamel junction for CAL measurement: A clinical crisis. J Indian Soc Periodontol 2009;13:12-5.  Back to cited text no. 36
[PUBMED]  Medknow Journal  
37.
Mombelli A, Casagni F, Madianos PN. Can presence or absence of periodontal pathogens distinguish between subjects with chronic and aggressive periodontitis? A systematic review. J Clin Periodontol 2002;29 Suppl 3:10-21.  Back to cited text no. 37
    
38.
Navazesh M. Methods for collecting saliva. Ann N Y Acad Sci 1993;694:72-7.  Back to cited text no. 38
    
39.
Listgarten MA, Helldén L. Relative distribution of bacteria at clinically healthy and periodontally diseased sites in humans. J Clin Periodontol 1978;5:115-32.  Back to cited text no. 39
    
40.
Checchi L, Felice P, Acciardi C, Ricci C, Gatta L, Polacci R, et al. Absence of Helicobacter pylori in dental plaque assessed by stool test. Am J Gastroenterol 2000;95:3005-6.  Back to cited text no. 40
    
41.
Savoldi E, Marinone MG, Negrini R, Facchinetti D, Lanzini A, Sapelli PL. Absence of Helicobacter pylori in dental plaque determined by immunoperoxidase. Helicobacter 1998;3:283-7.  Back to cited text no. 41
    
42.
Song Q, Lange T, Spahr A, Adler G, Bode G. Characteristic distribution pattern of Helicobacter pylori in dental plaque and saliva detected with nested PCR. J Med Microbiol 2000;49:349-53.  Back to cited text no. 42
    
43.
Andersen RN, Ganeshkumar N, Kolenbrander PE. Helicobacter pylori adheres selectively to Fusobacterium spp. Oral Microbiol Immunol 1998;13:51-4.  Back to cited text no. 43
    
44.
Okuda K, Kimizuka R, Katakura A, Nakagawa T, Ishihara K. Ecological and immunopathological implications of oral bacteria in Helicobacter pylori-infected disease. J Periodontol 2003;74:123-8.  Back to cited text no. 44
    
45.
Berroteran A, Perrone M, Correnti M, Cavazza ME, Tombazzi C, Goncalvez R, et al. Detection of Helicobacter pylori DNA in the oral cavity and gastroduodenal system of a Venezuelan population. J Med Microbiol 2002;51:764-70.  Back to cited text no. 45
    
46.
Martinez-Gomis J, Diouf A, Lakhssassi N, Sixou M. Absence of Helicobacter pylori in the oral cavity of 10 non-dyspeptic subjects demonstrated by real-time polymerase chain reaction. Oral Microbiol Immunol 2006;21:407-10.  Back to cited text no. 46
    
47.
Olivier BJ, Bond RP, van Zyl WB, Delport M, Slavik T, Ziady C, et al. Absence of Helicobacter pylori within the oral cavities of members of a healthy South African community. J Clin Microbiol 2006;44:635-6.  Back to cited text no. 47
    
48.
Zou QH, Li RQ. Helicobacter pylori in the oral cavity and gastric mucosa: A meta-analysis. J Oral Pathol Med 2011;40:317-24.  Back to cited text no. 48
    
49.
Li C, Ha T, Ferguson DA Jr., Chi DS, Zhao R, Patel NR, et al. A newly developed PCR assay of H. pylori in gastric biopsy, saliva, and feces. Evidence of high prevalence of H. pylori in saliva supports oral transmission. Dig Dis Sci 1996;41:2142-9.  Back to cited text no. 49
    
50.
Ferguson DA Jr., Li C, Patel NR, Mayberry WR, Chi DS, Thomas E. Isolation of Helicobacter pylori from saliva. J Clin Microbiol 1993;31:2802-4.  Back to cited text no. 50
    
51.
Bürgers R, Schneider-Brachert W, Reischl U, Behr A, Hiller KA, Lehn N, et al. Helicobacter pylori in human oral cavity and stomach. Eur J Oral Sci 2008;116:297-304.  Back to cited text no. 51
    
52.
Hardo PG, Tugnait A, Hassan F, Lynch DA, West AP, Mapstone NP, et al. Helicobacter pylori infection and dental care. Gut 1995;37:44-6.  Back to cited text no. 52
    
53.
Cammarota G, Tursi A, Montalto M, Papa A, Veneto G, Bernardi S, et al. Role of dental plaque in the transmission of Helicobacter pylori infection. J Clin Gastroenterol 1996;22:174-7.  Back to cited text no. 53
    
54.
Escobar EC. Full mouth ultrasonic debridement in Helicobacter pylori eradication from the oral cavity: A case series. Can J Dent Hyg 2013;47:450-5.  Back to cited text no. 54
    
55.
Zaric S, Bojic B, Jankovic LJ, Dapcevic B, Popovic B, Cakic S, et al. Periodontal therapy improves gastric Helicobacter pylori eradication. J Dent Res 2009;88:946-50.  Back to cited text no. 55
    
56.
Marbaix S, Soueidan A, Romani M, Campard G, Amador G, Badran Z. Helicobacter pylori and periodontal diseases: An update and proposal of a multidisciplinary clinical protocol. Open J Stomatol 2013;3:318-22.  Back to cited text no. 56
    
57.
Bernander S, Dalén J, Gästrin B, Hedenborg L, Lamke LO, Ohrn R. Absence of Helicobacter pylori in dental plaques in Helicobacter pylori positive dyspeptic patients. Eur J Clin Microbiol Infect Dis 1993;12:282-5.  Back to cited text no. 57
    
58.
Krajden S, Fuksa M, Anderson J, Kempston J, Boccia A, Petrea C, et al. Examination of human stomach biopsies, saliva, and dental plaque for Campylobacter pylori. J Clin Microbiol 1989;27:1397-8.  Back to cited text no. 58
    
59.
Dowsett SA, Kowolik MJ. Oral Helicobacter pylori: Can we stomach it? Crit Rev Oral Biol Med 2003;14:226-33.  Back to cited text no. 59
    



 
 
    Tables

  [Table 1], [Table 1a], [Table 2], [Table 3]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Materials And Me...
Results
Discussion
Conclusion
References
Article Tables

 Article Access Statistics
    Viewed1813    
    Printed48    
    Emailed0    
    PDF Downloaded216    
    Comments [Add]    

Recommend this journal